About   Help   FAQ
Ephx1ex7F, Ephx1ex7R Primer Detail
Primers
  • Name
    Ephx1ex7F, Ephx1ex7R
  • Primer 1 Sequence
    GCTGTGCTCTGAATGACTCT
  • Primer 2 Sequence
    CTCTCCAGGCCTCCATCC
  • ID
    MGI:1338260
  • Product Size
    109bp
Genes
Ephx1 epoxide hydrolase 1, microsomal
Polymorphisms
J:55357 Hartsfield JK Jr, et al., MGI Direct Data Submission. 1999;
Notes: Polymorphism detected within codon 338 in which the b allele is a C and the c allele is a T
Endonuclease Gene Allele Fragments Strains
Bsi YI Ephx1 b 86, 23bp 129P3/J, AKR/J, AU/SsJ, BALB/cByJ, C3H/HeJ, C57BL/6J, C57BLKS/J, C57BR/cdJ, C57L/J, HRS/J, LG/J, MA/MyJ, PL/J, RF/J, RIIIS/J, SEA/GnJ, SEC/1ReJ, SJL/J, SWR/J
d 109bp A/HeJ, A/J, BUB/BnJ, CBA/CaJ, CBA/J, DBA/1J, DBA/2J
References
J:55357 Hartsfield JK Jr, et al., Mapping of Ephx1 to Chromosome 1. MGI Direct Data Submission. 1999;
J:64722 Hartsfield JK Jr, et al., The ephx1(d) allele encoding an Arg338Cys substitution is associated with heat lability. Mamm Genome. 2000 Oct;11(10):915-8

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
05/26/2020
MGI 6.15
The Jackson Laboratory