About   Help   FAQ
D1Sta12-pA, D1Sta12-pB Primer Detail
Primers
  • Name
    D1Sta12-pA, D1Sta12-pB
  • Primer 1 Sequence
    GCAAGGCTTAAGAATGCCAC
  • Primer 2 Sequence
    AGCATCACAATCCTTCCCTG
  • ID
    MGI:1335157
  • Product Size
    0.130kb
Genes
D1Sta12 DNA segment, Chr 1, Philip Stanier 12
Sequences
AF084209 (GenBank | EMBL | ENA | DDBJ | MGI Sequence Detail)
References
J:52606 Eddleston J, et al., Physical and transcriptional map of a 3-Mb region of mouse chromosome 1 containing the gene for the neural tube defect mutant loop-tail (Lp). Genomics. 1999 Mar 1;56(2):149-59
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Copyright, and Privacy Statement
Send questions and comments to User Support.
last database update
11/22/2022
MGI 6.22
The Jackson Laboratory