About   Help   FAQ
Zfp106-pC, Zfp106-pD Primer Detail
Primers
  • Name
    Zfp106-pC, Zfp106-pD
  • Primer 1 Sequence
    GTGTTGGTGTCTTTGAGGGACA
  • Primer 2 Sequence
    GTCAGGAGGATTAATTCTGGC
  • ID
    MGI:1333185
  • Region Covered
    includes part of coding region
  • Product Size
    0.364kb
Genes
Zfp106 zinc finger protein 106
Polymorphisms
J:51335 Zuberi AR, et al., Immunity. 1998 Nov;9(5):687-98
Notes: Polymorphisms were detected by using SSCP.
Endonuclease Gene Allele Fragments Strains
SspI Zfp106 b 0.245, 0.119kb C57BL/6, C57BL/10
s 0.364kb 129, LP
References
J:51335 Zuberi AR, et al., Positional cloning and molecular characterization of an immunodominant cytotoxic determinant of the mouse H3 minor histocompatibility complex. Immunity. 1998 Nov;9(5):687-98

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
11/26/2019
MGI 6.14
The Jackson Laboratory