About   Help   FAQ
mTEAD2-pA, mTEAD2-pB Primer Detail
Primers
  • Name
    mTEAD2-pA, mTEAD2-pB
  • Primer 1 Sequence
    CTTCACGTCTGGAACATTCCATGG
  • Primer 2 Sequence
    TGGACAAGGGTCTGGACAACGAT
  • ID
    MGI:1332699
  • Region Covered
    includes the TEA binding domain; nt190..561 relative to Y10026
Genes
Tead2 TEA domain family member 2
Expression
  • Assay Results
    6
References
J:41029 Kaneko KJ, et al., Transcription factor mTEAD-2 is selectively expressed at the beginning of zygotic gene expression in the mouse. Development. 1997 May;124(10):1963-73

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
02/18/2020
MGI 6.14
The Jackson Laboratory