About   Help   FAQ
D16Wsu65e pA,pB Primer Detail
Primers
  • Name
    D16Wsu65e pA,pB
  • Primer 1 Sequence
    ACGTTTTAGAACATTTTAATATCC
  • Primer 2 Sequence
    TGCAGTCACTTGTAGTATCC
  • ID
    MGI:1332122
Genes
Adcy9 adenylate cyclase 9
Expression
  • Assay Results
    6
Sequences
AA407393 (GenBank | EMBL | ENA | DDBJ | MGI Sequence Detail)
References
J:50869 Ko MSH, et al., Genome-wide mapping of unselected transcripts from extraembryonic tissue of 7.5-day mouse embryos reveals enrichment in the t-complex and under-representation on the X chromosome. Hum Mol Genet. 1998 Nov;7(12):1967-78

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
08/03/2022
MGI 6.21
The Jackson Laboratory