About   Help   FAQ
p63-pA, p63-pB Primer Detail
Primers
  • Name
    p63-pA, p63-pB
  • Primer 1 Sequence
    TTCTGAGTTCGAGGCCAGTT
  • Primer 2 Sequence
    TGTAAATCCCCTGGACAGC
  • ID
    MGI:1331733
  • Region Covered
    intron 7
Genes
Trp63 transformation related protein 63
Polymorphisms
J:50106 Yang A, et al., Mol Cell. 1998 Sep;2(3):305-16
Endonuclease Gene Allele Fragments Strains
Trp63 b not given C57BL/6J
s not given M. spretus
References
J:50106 Yang A, et al., p63, a p53 homolog at 3q27-29, encodes multiple products with transactivating, death-inducing, and dominant-negative activities. Mol Cell. 1998 Sep;2(3):305-16

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
09/15/2020
MGI 6.15
The Jackson Laboratory