About   Help   FAQ
D9Mgc47e-pA, D9Mgc47e-pB Primer Detail
Primers
  • Name
    D9Mgc47e-pA, D9Mgc47e-pB
  • Primer 1 Sequence
    GAGGCTTTTGCACACATTCA
  • Primer 2 Sequence
    TGGTTGTCAACAATGTGGCT
  • ID
    MGI:1331055
  • Product Size
    142bp
Genes
D9Mgc47e DNA segment, Chr 9, MRC UK Mouse Genome Centre 47 expressed
References
J:52081 Blanco G, et al., A STS content physical and transcription map across the ky, kyphoscoliosis, nonrecombinant region. Genomics. 1998 Dec 15;54(3):415-23

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
02/11/2020
MGI 6.14
The Jackson Laboratory