About   Help   FAQ
IL-3 receptor-pC, IL-3 receptor-pD Primer Detail
Primers
  • Name
    IL-3 receptor-pC, IL-3 receptor-pD
  • Primer 1 Sequence
    GCATACAAGCTTAGTTGTGG
  • Primer 2 Sequence
    TCTTAACATGGAGGCCGTTC
  • ID
    MGI:1329051
Genes
Csf2rb2 colony stimulating factor 2 receptor, beta 2, low-affinity (granulocyte-macrophage)
Expression
  • Assay Results
    3
References
J:50693 Keller G, et al., Hematopoietic commitment during embryonic stem cell differentiation in culture. Mol Cell Biol. 1993 Jan;13(1):473-86
J:26846 Shalaby F, et al., Failure of blood-island formation and vasculogenesis in Flk-1-deficient mice. Nature. 1995 Jul 6;376(6535):62-6

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
05/26/2020
MGI 6.15
The Jackson Laboratory