About   Help   FAQ
Hba-x-pA, Hba-x-pB Primer Detail
Primers
  • Name
    Hba-x-pA, Hba-x-pB
  • Primer 1 Sequence
    GCTCAGGCCGAGCCCATTGG
  • Primer 2 Sequence
    TAGCGGTACTTCTCAGTCAG
  • ID
    MGI:1328823
  • Product Size
    0.37kb
Genes
Hba-x hemoglobin X, alpha-like embryonic chain in Hba complex
Expression
  • Assay Results
    7
References
J:19573 Weiss MJ, et al., Novel insights into erythroid development revealed through in vitro differentiation of GATA-1 embryonic stem cells. Genes Dev. 1994 May 15;8(10):1184-97
J:23061 Shivdasani RA, et al., Absence of blood formation in mice lacking the T-cell leukaemia oncoprotein tal-1/SCL. Nature. 1995 Feb 2;373(6513):432-4
J:36249 Fujiwara Y, et al., Arrested development of embryonic red cell precursors in mouse embryos lacking transcription factor GATA-1. Proc Natl Acad Sci U S A. 1996 Oct 29;93(22):12355-8
J:40963 Niki M, et al., Hematopoiesis in the fetal liver is impaired by targeted mutagenesis of a gene encoding a non-DNA binding subunit of the transcription factor, polyomavirus enhancer binding protein 2/core binding factor. Proc Natl Acad Sci U S A. 1997 May 27;94(11):5697-702

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
05/19/2020
MGI 6.15
The Jackson Laboratory