About   Help   FAQ
Tnfa-pA, Tnfa-pB Primer Detail
Primers
  • Name
    Tnfa-pA, Tnfa-pB
  • Primer 1 Sequence
    GGACAGAGAAGAAATGGGTTTC
  • Primer 2 Sequence
    TCGAATCTGGGGCCAATCAGGAGGG
  • ID
    MGI:1313161
  • Region Covered
    promoter region
Genes
Tnf tumor necrosis factor
Polymorphisms
J:50015 Iraqi F, et al., Immunogenetics. 1998 Sep;48(4):302-4
Endonuclease Gene Allele Fragments Strains
Tnf b 103bp 129P3/J, C57BL/6J, C57BL/10J
d 93bp A/J, A/WySnJ, BALB/c, DBA/2J
k 95bp AKR/J, C3H/HeJ, C57BR/cdJ
q 101bp DBA/1J, SWR/J
References
J:50015 Iraqi F, et al., Polymorphism in the microsatellite located in the promoters of the Tnfa and Tnfb genes of different mouse strains. Immunogenetics. 1998 Sep;48(4):302-4

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
12/03/2019
MGI 6.14
The Jackson Laboratory