About   Help   FAQ
Ucp-pA, Ucp-pB Primer Detail
Primers
  • Name
    Ucp-pA, Ucp-pB
  • Primer 1 Sequence
    GGTCAAGATCTTCTCAGCCG
  • Primer 2 Sequence
    AGGCAGACCGCTGTACAGTT
  • ID
    MGI:1278410
Genes
Ucp1 uncoupling protein 1 (mitochondrial, proton carrier)
Polymorphisms
J:48971 Grewal PK, et al., Mamm Genome. 1998 Aug;9(8):603-7
Notes: These primers were used for SSCP mapping.
Endonuclease Gene Allele Fragments Strains
Not Specified Ucp1 b ~1000bp C57BL/6J
s ~1000bp SPR
References
J:48971 Grewal PK, et al., High-resolution mapping of mouse chromosome 8 identifies an evolutionary chromosomal breakpoint. Mamm Genome. 1998 Aug;9(8):603-7

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
09/13/2022
MGI 6.21
The Jackson Laboratory