About   Help   FAQ
Cfl1-a, Cfl1-z Primer Detail
Primers
  • Name
    Cfl1-a, Cfl1-z
  • Primer 1 Sequence
    CAACCTATGAGAGCAAGGAGAGCA
  • Primer 2 Sequence
    CTTGACCTTCCTCGTAGCAGTTAG
  • ID
    MGI:1202447
Genes
Cfl1 cofilin 1, non-muscle
References
J:46654 Fernandes M, et al., The mouse homologs of human GIF, DDB1, and CFL1 genes are located on chromosome 19. Mamm Genome. 1998 Apr;9(4):339

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
01/07/2020
MGI 6.14
The Jackson Laboratory