About   Help   FAQ
Og12x-pA, Og12x-pB Primer Detail
Primers
  • Name
    Og12x-pA, Og12x-pB
  • Primer 1 Sequence
    TGTGGTTCAAGAACCGGC
  • Primer 2 Sequence
    TTGACCGAGTTGAAGGCGAA
  • ID
    MGI:1201983
  • Region Covered
    part of 3' untranslated region
Genes
Shox2 short stature homeobox 2
References
J:46366 Semina EV, et al., A new human homeobox gene OGI2X is a member of the most conserved homeobox gene family and is expressed during heart development in mouse. Hum Mol Genet. 1998 Mar;7(3):415-22

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
02/11/2020
MGI 6.14
The Jackson Laboratory