About   Help   FAQ
Stac-pA, Stac-pB Primer Detail
Primers
  • Name
    Stac-pA, Stac-pB
  • Primer 1 Sequence
    TTTCAGTTGGGGTGGGTTTTT
  • Primer 2 Sequence
    CGCAGTGTGGTATGTTCTTGT
  • ID
    MGI:1201560
Genes
Stac src homology three (SH3) and cysteine rich domain
Expression
  • Assay Results
    26
Polymorphisms
J:42515 Kawai J, et al., Genomics. 1998 Jan 1;47(1):140-2
Endonuclease Gene Allele Fragments Strains
PvuII Stac b 0.222, 0.129kb C57BL/6
s 0.351kb M. spretus
References
J:42515 Kawai J, et al., Human and mouse chromosomal mapping of Stac, a neuron-specific protein with an SH3 domain. Genomics. 1998 Jan 1;47(1):140-2
J:142548 Fujimoto M, et al., Analysis of HSF4 binding regions reveals its necessity for gene regulation during development and heat shock response in mouse lenses. J Biol Chem. 2008 Oct 31;283(44):29961-70

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
02/16/2021
MGI 6.16
The Jackson Laboratory