About   Help   FAQ
Mod1-2, Mod1-3 Primer Detail
Primers
  • Name
    Mod1-2, Mod1-3
  • Primer 1 Sequence
    GTACCCGTTTTAGCTCACACC
  • Primer 2 Sequence
    AGACAAGCTCAGGCCTCCATG
  • ID
    MGI:1201421
  • Region Covered
    3' untranslated region
  • Product Size
    373bp
Genes
Me1 malic enzyme 1, NADP(+)-dependent, cytosolic
Polymorphisms
J:46257 Pearsall RS, et al., Mamm Genome. 1998 Mar;9(3):261-2
Endonuclease Gene Allele Fragments Strains
TaqI Me1 b 373bp C57BL/6
s 250, 1206bp M. spretus
References
J:46257 Pearsall RS, et al., The Rasgrf1-repeat sequence (D9Ncvs53) maps between Mod1 and Rbp1 on mouse chromosome 9 and may define a putative imprinted region. Mamm Genome. 1998 Mar;9(3):261-2

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
01/14/2020
MGI 6.14
The Jackson Laboratory