About   Help   FAQ
Pitx3-pA, Pitx3-pB Primer Detail
Primers
  • Name
    Pitx3-pA, Pitx3-pB
  • Primer 1 Sequence
    TGTGGTTCAAGAACCGGC
  • Primer 2 Sequence
    TTGACCGAGTTGAAGGCGAA
  • ID
    MGI:1101191
  • Region Covered
    portion of coding region
Genes
Pitx3 paired-like homeodomain transcription factor 3
References
J:43830 Semina EV, et al., Isolation of a new homeobox gene belonging to the Pitx/Rieg family: expression during lens development and mapping to the aphakia region on mouse chromosome 19. Hum Mol Genet. 1997 Nov;6(12):2109-16

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
02/18/2020
MGI 6.14
The Jackson Laboratory