Summary | Mutation origin | Mutation description | Find Mice (IMSR) | References

Symbol:	Slc25a13em1(IMPC)Hmgu
Name:	solute carrier family 25 (mitochondrial carrier, adenine nucleotide translocator), member 13; endonuclease-mediated mutation 1, Helmholtz Zentrum Muenchen GmbH
MGI ID:	MGI:6388371
Gene:	Slc25a13  Location: Chr6:6041218-6217173 bp, - strand  Genetic Position: Chr6, 2.3 cM, cytoband A1
Alliance:	Slc25a13em1(IMPC)Hmgu page
IMPC:	Slc25a13 gene page

Strain of Origin:	C57BL/6NCrl
Project Collection:	IMPC

Allele Type:    Endonuclease-mediated (Null/knockout) Mutation:    Intragenic deletion   Mutation details: This allele from IMPC was generated at Helmholtz-Zentrum Muenchen by injecting CAS9 Protein and 4 guide sequences CCTCCATCGCGATTACAGGCATG, CCGACCTGAAGCCGTCAGAGCGA, CCTCGTAGTAATATCACACCTGG, CCTGATTGGTTCTATGCAGTAGA, which resulted in a Exon Deletion. (J:265051) Inheritance:    Not Specified

Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:	Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Slc25a13 Mutation:	178 strains or lines available

Original:	J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023;
All:	1 reference(s)