About   Help   FAQ
Twist1em1(IMPC)Rbrc
Endonuclease-mediated Allele Detail
Nomenclature
Symbol: Twist1em1(IMPC)Rbrc
Name: twist basic helix-loop-helix transcription factor 1; endonuclease-mediated mutation 1, RIKEN BioResource Center
MGI ID: MGI:6379556
Gene: Twist1  Location: Chr12:33957671-33959829 bp, + strand  Genetic Position: Chr12, 14.81 cM, cytoband B-C1
Mutation
origin
Strain of Origin:  C57BL/6NJcl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Deletion
 
Mutation detailsThis allele from IMPC was generated at RIKEN BioResource Research Center by injecting CAS9 Protein and 2 guide sequences CAAACTTTCCGCCCGCACGGAGG, TAACTCTAGGGGCATCTAGGAGG, which resulted in a Whole-gene deletion. (J:265051)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Twist1 Mutation:  9 strains or lines available
References
Original:  J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
01/05/2021
MGI 6.16
The Jackson Laboratory