Nomenclature | Mutation origin | Mutation description | Find Mice (IMSR) | References

Symbol:	Twist1em1(IMPC)Rbrc
Name:	twist basic helix-loop-helix transcription factor 1; endonuclease-mediated mutation 1, RIKEN BioResource Center
MGI ID:	MGI:6379556
Gene:	Twist1  Location: Chr12:33957671-33959829 bp, + strand  Genetic Position: Chr12, 14.81 cM, cytoband B-C1

Strain of Origin:	C57BL/6NJcl
Project Collection:	IMPC

Allele Type:    Endonuclease-mediated (Null/knockout) Mutation:    Deletion   Mutation details: This allele from IMPC was generated at RIKEN BioResource Research Center by injecting CAS9 Protein and 2 guide sequences CAAACTTTCCGCCCGCACGGAGG, TAACTCTAGGGGCATCTAGGAGG, which resulted in a Whole-gene deletion. (J:265051) Inheritance:    Not Specified

Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:	Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Twist1 Mutation:	9 strains or lines available

Original:	J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018;
All:	1 reference(s)