Summary | Mutation origin | Mutation description | Expression | Find Mice (IMSR) | References

Symbol:	Etv2em1Djg
Name:	ets variant 2; endonuclease-mediated mutation 1, Daniel J Garry
MGI ID:	MGI:6358103
Synonyms:	Etv2 Mut
Gene:	Etv2  Location: Chr7:30333041-30335277 bp, - strand  Genetic Position: Chr7, 18.92 cM, cytoband A3
Alliance:	Etv2em1Djg page

Strain of Origin:

C57BL/6J

Allele Type:    Endonuclease-mediated (Null/knockout) Mutation:    Intragenic deletion   Mutation details: The 3.9-kb promoter upstream of Etv2 was deleted using gRNAs (targeting AATGCAAGCTTACCCCCAGC and GCCAGAGGTGAGCCACGAAC) with CRISPR/Cas9 technology. (J:276308)

In Mice Carrying this Mutation:

5 assay results

Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:	Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Etv2 Mutation:	14 strains or lines available

Original:	J:276308 Koyano-Nakagawa N, et al., Feedback Mechanisms Regulate Ets Variant 2 (Etv2) Gene Expression and Hematoendothelial Lineages. J Biol Chem. 2015 Nov 20;290(47):28107-19
All:	1 reference(s)