About   Help   FAQ
Nansem1(IMPC)Tcp
Endonuclease-mediated Allele Detail
Summary
Symbol: Nansem1(IMPC)Tcp
Name: N-acetylneuraminic acid synthase (sialic acid synthase); endonuclease-mediated mutation 1, The Centre for Phenogenomics
MGI ID: MGI:6316200
Gene: Nans  Location: Chr4:46489319-46503439 bp, + strand  Genetic Position: Chr4, 24.83 cM, cytoband B2
Alliance: Nansem1(IMPC)Tcp page
IMPC: Nans gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project TCPR1155 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs with spacer sequences of TTCTTGTAGCAACTGATGGC and GAGGGAATACCTTTCACTAT targeting the 5' side and TAGTGTCGTGTGGAGACGTT and ATGGAAGCAGGTCGTATTAC targeting the 3' side of a critical exon. This resulted in a 673-bp del Chr4:46498890 to 46499562 with an insertion of 152-bp resulting in a frameshift mutation in all annotated full length protein-coding transcripts. (GRCm38) (J:200814)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Nans Mutation:  19 strains or lines available
References
Original:  J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/30/2024
MGI 6.23
The Jackson Laboratory