Summary | Mutation origin | Mutation description | Find Mice (IMSR) | References

Symbol:	Klf8em2(IMPC)Tcp
Name:	Kruppel-like transcription factor 8; endonuclease-mediated mutation 2, The Centre for Phenogenomics
MGI ID:	MGI:6316194
Gene:	Klf8  Location: ChrX:152020462-152179128 bp, + strand  Genetic Position: ChrX, 68.46 cM
Alliance:	Klf8em2(IMPC)Tcp page
IMPC:	Klf8 gene page

Strain of Origin:	C57BL/6NCrl
Project Collection:	IMPC

Allele Type:    Endonuclease-mediated (Null/knockout) Mutation:    Intragenic deletion   Mutation details: This allele from project TCPR861was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs single guide RNA(s) with spacer sequences of GTAATACCAGTTCTTAACAA and TCTCTTTAGACTACCAACGG targeting the 5' side and AGACGGCAAAAGTGCTGGAT and TTCACCGTTTGCAATTTTGA targeting the 3' side leading to a 737-bp deletion from ChrX:153382331 to 153383067; 1-bp deletion ChrX:153383168_delT resulting in a frameshift mutation in all annotated full length protein-coding transcripts (GRCm38). (J:200814)

Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:	Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Klf8 Mutation:	67 strains or lines available

Original:	J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013;
All:	1 reference(s)