Summary | Mutation origin | Mutation description | Find Mice (IMSR) | References

Symbol:	Sardhem1(IMPC)Bay
Name:	sarcosine dehydrogenase; endonuclease-mediated mutation 1, Baylor College of Medicine
MGI ID:	MGI:6306624
Gene:	Sardh  Location: Chr2:27078405-27138344 bp, - strand  Genetic Position: Chr2, 19.31 cM
Alliance:	Sardhem1(IMPC)Bay page
IMPC:	Sardh gene page

Strain of Origin:	C57BL/6NJ
Project Collection:	IMPC

Allele Type:    Endonuclease-mediated (Null/knockout) Mutation:    Intragenic deletion   Mutation details: This allele from IMPC was generated at Bayor College of Medicine by injecting CAS9 Protein and 4 guide sequences CCTTCCATGCCAAGGAATTATAC, CCATGAGGTTTACACCCCACCTT, GCTCCTAGTGACAATATTTAGGG, CCACAGGTGGAGGTTAGGGCTAT, which resulted in a Exon Deletion. (J:265051) Inheritance:    Not Specified

Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:	Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Sardh Mutation:	60 strains or lines available

Original:	J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023;
All:	2 reference(s)