Summary | Mutation origin | Mutation description | Expression | Phenotypes | Find Mice (IMSR) | References

Symbol:	Tspan32em1(IMPC)Mbp
Name:	tetraspanin 32; endonuclease-mediated mutation 1, Mouse Biology Program, UC Davis
MGI ID:	MGI:6293843
Gene:	Tspan32  Location: Chr7:142558644-142573223 bp, + strand  Genetic Position: Chr7, 88.09 cM
Alliance:	Tspan32em1(IMPC)Mbp page
IMPC:	Tspan32 gene page

Strain of Origin:	C57BL/6NCrl
Project Collection:	IMPC

Allele Type:    Endonuclease-mediated (Null/knockout) Mutation:    Intragenic deletion   Mutation details: This allele from IMPC was generated at UC Davies by injecting CAS9 Protein and 2 guide sequences GGGCCCCTGAAAGAGAGAATTGG, GAGGACAGGCTATTGGGCTATGG, which resulted in a Exon Deletion. (J:265051) Inheritance:    Not Specified

View phenotypes and curated references for all genotypes (concatenated display).

In Structures Affected by this Mutation:

10 anatomical structure(s)

Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:	Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Tspan32 Mutation:	29 strains or lines available

Original:	J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023;
All:	2 reference(s)