Summary | Mutation origin | Mutation description | Expression | Phenotypes | Find Mice (IMSR) | References

Symbol:	Epas1em1(IMPC)Wtsi
Name:	endothelial PAS domain protein 1; endonuclease-mediated mutation 1, Wellcome Trust Sanger Institute
MGI ID:	MGI:6257575
Gene:	Epas1  Location: Chr17:87061292-87140838 bp, + strand  Genetic Position: Chr17, 56.9 cM
Alliance:	Epas1em1(IMPC)Wtsi page
IMPC:	Epas1 gene page

Strain of Origin:	C57BL/6N
Project Collection:	IMPC

Allele Type:    Endonuclease-mediated Mutation:    Single point mutation   Mutation details: This allele from IMPC was generated at Welcome Trust Sanger Institute by injecting CAS9 RNA, the guide sequence CCCCAGGTCCTGCACTGCACCGG, and a donor oligo, which resulted in a Point Mutation allele. (J:265051) Inheritance:    Not Specified

View phenotypes and curated references for all genotypes (concatenated display).

In Structures Affected by this Mutation:

1 anatomical structure(s)

Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:	Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Epas1 Mutation:	64 strains or lines available

Original:	J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023;
All:	3 reference(s)