Summary | Mutation origin | Mutation description | Find Mice (IMSR) | References

Symbol:	Inhaem1(IMPC)Cnrm
Name:	inhibin alpha; endonuclease-mediated mutation 1, Monterotondo
MGI ID:	MGI:6257434
Gene:	Inha  Location: Chr1:75483721-75487010 bp, + strand  Genetic Position: Chr1, 39.16 cM, cytoband C5
Alliance:	Inhaem1(IMPC)Cnrm page
IMPC:	Inha gene page

Strain of Origin:	C57BL/6N
Project Collection:	IMPC

Allele Type:    Endonuclease-mediated Mutation:    Single point mutation   Mutation details: This allele from IMPC was generated at CNR Monterotondo by injecting CAS9 RNA, the guide sequence GGGGCGCAGAGCTATTGGCGG, and a donor oligo, which resulted in a Point Mutation allele. (J:265051) Inheritance:    Not Specified

Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:	Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Inha Mutation:	9 strains or lines available

Original:	J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023;
All:	1 reference(s)