Mvdem1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Mvdem1(IMPC)J |
Name: |
mevalonate (diphospho) decarboxylase; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:6196088 |
Gene: |
Mvd Location: Chr8:123160340-123170161 bp, - strand Genetic Position: Chr8, 71.05 cM
|
Alliance: |
Mvdem1(IMPC)J page
|
IMPC: |
Mvd gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences CGGACGTAAAACCAACCCCG, TCACTGCCCAGATACAGCCG, GATGGTCAACGGGAATTAGG and TGAACCTTCCCAGAGCACAG, which resulted in a 428 bp deletion beginning at Chromosome 8 position 122,440,127 bp and ending after 122,440,554 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000215074 (exon 2) and 357 bp of flanking intronic sequence including the splice acceptor and donor. This exon deletion is predicted to cause a change of amino acid sequence after residue 24 and early truncation 9 amino acids later. In addition, there are 2 smaller intronic deletions before the 428 bp deletion, neither of which should alter the results of the exon deletion: a 16 bp deletion (CAACCCCGTGGCTTTG) and a single bp (T) deletion that are 71 bp and 15 bp before the 428 bp deletion, respectively.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
2 reference(s) |
|