Summary | Mutation origin | Mutation description | Phenotypes | Find Mice (IMSR) | References

Symbol:	Mvdem1(IMPC)J
Name:	mevalonate (diphospho) decarboxylase; endonuclease-mediated mutation 1, Jackson
MGI ID:	MGI:6196088
Gene:	Mvd  Location: Chr8:123160340-123170161 bp, - strand  Genetic Position: Chr8, 71.05 cM
Alliance:	Mvdem1(IMPC)J page
IMPC:	Mvd gene page

Strain of Origin:	C57BL/6NJ
Project Collection:	IMPC

Allele Type:    Endonuclease-mediated (Null/knockout) Mutation:    Intragenic deletion   Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences CGGACGTAAAACCAACCCCG, TCACTGCCCAGATACAGCCG, GATGGTCAACGGGAATTAGG and TGAACCTTCCCAGAGCACAG, which resulted in a 428 bp deletion beginning at Chromosome 8 position 122,440,127 bp and ending after 122,440,554 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000215074 (exon 2) and 357 bp of flanking intronic sequence including the splice acceptor and donor. This exon deletion is predicted to cause a change of amino acid sequence after residue 24 and early truncation 9 amino acids later. In addition, there are 2 smaller intronic deletions before the 428 bp deletion, neither of which should alter the results of the exon deletion: a 16 bp deletion (CAACCCCGTGGCTTTG) and a single bp (T) deletion that are 71 bp and 15 bp before the 428 bp deletion, respectively. (J:188991) Inheritance:    Not Specified

View phenotypes and curated references for all genotypes (concatenated display).

Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:	Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Mvd Mutation:	23 strains or lines available

Original:	J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:	2 reference(s)