About   Help   FAQ
Prkag2em1(IMPC)J
Endonuclease-mediated Allele Detail
Nomenclature
Symbol: Prkag2em1(IMPC)J
Name: protein kinase, AMP-activated, gamma 2 non-catalytic subunit; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5829423
Synonyms: Prkag2em1J
Gene: Prkag2  Location: Chr5:25067742-25305640 bp, - strand  Genetic Position: Chr5, 11.93 cM
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Prkag2-8317J-M9745 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTACCTGCTCTAGTCCTCCG, TTGATGCTATGGTTTCAGGT, GCTGTCTAACAGAGCCTCAA and GCATTCCCTTGTCACCTCTG, which resulted in a 686 bp deletion beginning at Chromosome 5 negative strand position 25,022,291 bp AGGCTCTGTTAGACAGCTCC, and ending after TGCTCTAGTCCTCCGGGGTG at 25,021,606 bp (GRCm38/mm10). This mutation deletes exon 3 and 406 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 82 and early truncation 13 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Prkag2 Mutation:  37 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer & Copyright Notice
Send questions and comments to User Support.
last database update
05/17/2022
MGI 6.19
The Jackson Laboratory