Summary | Mutation origin | Mutation description | Expression | Phenotypes | Find Mice (IMSR) | References

Symbol:	Gnb2em1(IMPC)J
Name:	guanine nucleotide binding protein (G protein), beta 2; endonuclease-mediated mutation 1, Jackson
MGI ID:	MGI:5817218
Synonyms:	Gnb2em1J
Gene:	Gnb2  Location: Chr5:137526389-137531772 bp, - strand  Genetic Position: Chr5, 76.54 cM
Alliance:	Gnb2em1(IMPC)J page
IMPC:	Gnb2 gene page

Strain of Origin:	C57BL/6NJ
Project Collection:	IMPC

Allele Type:    Endonuclease-mediated (Null/knockout) Mutation:    Intragenic deletion   Mutation details: This allele from project Gnb2-8128J-M9422 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TCCCATTCTTCAGTGCCCCA, ATGGGCAGAATGATAGTACA, TCCCATTCTTCAGTGCCCCA and ATGATGGGCAGTGCAAGAGA, which resulted in a 359 bp deletion beginning at Chromosome 5 negative strand position 137,530,468 bp, TTTCCCTCTCTTGCACTGCC, and ending after ATGGGCAGAATGATAGTACA at 137,530,110 bp (GRCm38/mm10). This mutation deletes all of exons 3 and 4 and 106 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 2bp (AA) deletion 90 bp before the large deletion that will not effect the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 19 and early truncation 19 amino acids later. (J:188991) Inheritance:    Not Specified

View phenotypes and curated references for all genotypes (concatenated display).

In Structures Affected by this Mutation:

3 anatomical structure(s)

Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:	Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Gnb2 Mutation:	20 strains or lines available

Original:	J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:	3 reference(s)