About   Help   FAQ
Rr249tm1.1Ebres
Targeted Allele Detail
Summary
Symbol: Rr249tm1.1Ebres
Name: regulatory region 249; targeted mutation 1.1, Emery H Bresnick
MGI ID: MGI:5466176
Synonyms: +9.5-, Gata2tm1.1Ebres
Gene: Rr249  Location: unknown  Genetic Position: Chr6, Syntenic
Alliance: Rr249tm1.1Ebres page
Hemorrhage in Rr249tm1.1Ebres/Rr249tm1.1Ebres embryos

Show the 3 phenotype image(s) involving this allele.

Mutation
origin
Germline Transmission:  Earliest citation of germline transmission: J:191756
Parent Cell Line:  CJ9 (ES Cell)
Strain of Origin:  129S1/Sv-Oca2+ Tyr+ Kitl+
Mutation
description
Allele Type:    Targeted (Not Applicable)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsA loxP site flanked neomycin resistance gene cassette replaced the 46 bp E-box GATA motif (CATCTGCAGCCGGTAGATAA; WGATAR) at the +9.5 kb Gata2 enhancer site in intron 4. Cre-mediated recombination removed the neo cassette. RT-PCR confirmed reduced transcript expression in the liver. (J:191756)
Generation of the Rr249tm1.1Ebres allele
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Mice Carrying this Mutation: 1 RNA-Seq or microarray experiment(s)
In Structures Affected by this Mutation: 5 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Rr249 Mutation:  0 strains or lines available
References
Original:  J:191756 Johnson KD, et al., Cis-element mutated in GATA2-dependent immunodeficiency governs hematopoiesis and vascular integrity. J Clin Invest. 2012 Oct 1;122(10):3692-704
All:  5 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/30/2024
MGI 6.23
The Jackson Laboratory