Summary | Mutation origin | Mutation description | Expression | Phenotypes | Find Mice (IMSR) | References

Symbol:	Npm1tm1Gsva
Name:	nucleophosmin 1; targeted mutation 1, George S Vassiliou
MGI ID:	MGI:5004857
Synonyms:	Npm1flox-cA
Gene:	Npm1  Location: Chr11:33102287-33113206 bp, - strand  Genetic Position: Chr11, 19.21 cM
Alliance:	Npm1tm1Gsva page

Germline Transmission:	Earliest citation of germline transmission: J:172071
Parent Cell Line:	Not Specified (ES Cell)
Strain of Origin:	Not Specified

Allele Type:    Targeted (Conditional ready, Humanized sequence) Mutations:    Insertion, Intragenic deletion   Mutation details: A loxP site was inserted into intron 10 and a puromycin resistance gene cassette, a second loxP site and a modified exon 11 into intron 11. The exon modification involves replacing the end of the endogenous coding sequence and start of 3' UTR with the equivalent sequence for the human A variant of NPM1, which has a frameshift and slightly longer translated sequence: mouse sequence GCAGTGGAGGAAATCTCTTTAAGAAAAGG (reverse strand) was replaced with human sequence TCTGGCAGTGGAGGAAGTCTCTTTAAGAAAATA. (J:175778)

View phenotypes and curated references for all genotypes (concatenated display).

In Structures Affected by this Mutation:

2 anatomical structure(s)

Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:	Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Npm1 Mutation:	33 strains or lines available

Original:	J:172071 Vassiliou GS, et al., Mutant nucleophosmin and cooperating pathways drive leukemia initiation and progression in mice. Nat Genet. 2011 May;43(5):470-5
All:	11 reference(s)