Gt(ROSA)26Sor^{em2(CAG-BCL2)Jich}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gt(ROSA)26Sor^{em2(CAG-BCL2)Jich}
• Name: gene trap ROSA 26, Philippe Soriano; endonuclease-mediated mutation 2, Jichao Chen
• MGI ID: MGI:8404123
• Synonyms: Rosa^BCL2+F
• Gene: Gt(ROSA)26Sor Location: Chr6:113044389-113054205 bp, - strand Genetic Position: Chr6, 52.73 cM
• Alliance: Gt(ROSA)26Sor^{em2(CAG-BCL2)Jich} page

Mutation origin

• Strain of Origin: C57BL/6NCrl

Mutation description

• Allele Type: Endonuclease-mediated (Conditional ready, Epitope tag, Inserted expressed sequence)
• Mutation: Insertion
• Gt(ROSA)26Sor^{em2(CAG-BCL2)Jich} expresses 1 gene
  Knock-in expresses:
  

  Organism

  Expressed Gene

  Homolog in Mouse

  Note

  human

  BCL2 (596)

  Bcl2	(MGI:88138)

• Mutation details:

  Using CRISPR/Cas9 technology, gRNA (ACTCCAGTCTTTCTAGAAGATGG), the targeting vector was designed based on Ai65 with (from 5' to 3') a chicken beta-actin (CAG) promoter, a frt-flanked STOP cassette (with polyA translational stops in all three reading frames), a loxP-flanked STOP cassette (with stop codons in all three reading frames linked to three repeats of the SV40 polyA signal), a sequence encoding flag-tagged human B cell leukemia/lymphoma 2 (BCL2) cDNA, and a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE; to enhance the mRNA transcript stability) targeted to the Gt(ROSA)26Sor locus. The targeting vector contains a neo cassette and remains in this allele. (J:101977, J:392022)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Gt(ROSA)26Sor Mutation: 1243 strains or lines available

References

• Original: J:392022 Gacha-Garay MJ, et al., Apoptosis inhibition reprograms alveolar myofibroblasts toward ductal myofibroblasts. Cell Rep. 2026 Sep 7;45(9):117891
• All: 2 reference(s)