Ptprg^{em1(PTPRG/Citrine)Wbrn}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ptprg^{em1(PTPRG/Citrine)Wbrn}
• Name: protein tyrosine phosphatase receptor type G; endonuclease-mediated mutation 1, Walter Boron
• MGI ID: MGI:8386635
• Gene: Ptprg Location: Chr14:10227722-10916220 bp, - strand Genetic Position: Chr14, 6.33 cM, cytoband A2
• Alliance: Ptprg^{em1(PTPRG/Citrine)Wbrn} page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence, Inserted expressed sequence, Null/knockout, Reporter)
• Mutations: Insertion, Intragenic deletion
• Ptprg^{em1(PTPRG/Citrine)Wbrn} expresses 1 gene
  Knock-in expresses:
  

  Organism

  Expressed Gene

  Homolog in Mouse

  Note

  human

  PTPRG (5793)

  Ptprg

  (MGI:97814)

• Mutation details:

  A donor vector and gRNA (GTGCGTTTTCGGACATGCGGAGG) were designed to replace the ATG start codon and partial upstream sequence in exon 1 of the endogenous protein tyrosine phosphatase receptor type G (Ptprg) gene with the human PTPRG open reading frame (ORF) cDNA fused with a C-terminal Citrine yellow fluorescent protein sequence and a SV40pA cassette. (J:101977)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Ptprg Mutation: 115 strains or lines available

References

• Original: J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017
• All: 1 reference(s)