2310002F09Rik^{em1(IMPC)Ccpcz}
Endonuclease-mediated Allele Detail

Summary

• Symbol: 2310002F09Rik^{em1(IMPC)Ccpcz}
• Name: RIKEN cDNA 2310002F09 gene; endonuclease-mediated mutation 1, Institute of Molecular Genetics
• MGI ID: MGI:8346426
• Gene: 2310002F09Rik Location: Chr7:43394890-43405360 bp, - strand Genetic Position: Chr7, 28.26 cM
• Alliance: 2310002F09Rik^{em1(IMPC)Ccpcz} page
• IMPC: 2310002F09Rik gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Deletion
• Mutation details: This allele was generated at Czech Centre for Phenogenomics using Cas9 and guides with spacer sequences CAGCATGAGGTCATTATCGT and GTTCATCTGAGCGATGTGGC that targeted exon(s) ENSMUSE00000202063.4 ENSMUSE00000202078.7 ENSMUSE00000202087.4 ENSMUSE00000202117.4 ENSMUSE00000289668.6 ENSMUSE00000333348.6 ENSMUSE00000370128.7 ENSMUSE00000407748.4 ENSMUSE00000412603.6 ENSMUSE00000445716.5 ENSMUSE00000445722.4 ENSMUSE00000508712.3 ENSMUSE00000509695.3 ENSMUSE00000519920.3 ENSMUSE00000520927.7 ENSMUSE00000532711.3 ENSMUSE00000595664.6 ENSMUSE00000595680.2 ENSMUSE00000595688.5 ENSMUSE00000595689.2 ENSMUSE00000595690.2 ENSMUSE00000675052.3 ENSMUSE00000675053.2 ENSMUSE00000675054.2 ENSMUSE00000675055.2 ENSMUSE00000894197.2 ENSMUSE00000894815.2 ENSMUSE00000993425.2 ENSMUSE00001096200.2 ENSMUSE00001096986.2 ENSMUSE00001123011.3 ENSMUSE00001135797.2 ENSMUSE00001147247.2 ENSMUSE00001166788.2 ENSMUSE00001189210.2 ENSMUSE00001372544.2 ENSMUSE00001374519.2 ENSMUSE00001374741.2 ENSMUSE00001565187.1 ENSMUSE00001565191.1 ENSMUSE00001565194.1 ENSMUSE00001565196.1 ENSMUSE00001565197.1 ENSMUSE00001565199.1 ENSMUSE00001565200.1 ENSMUSE00001565201.1 ENSMUSE00001565202.1 ENSMUSE00001565203.1 ENSMUSE00001565208.1 ENSMUSE00001565209.1 ENSMUSE00001565210.1. This resulted in deletion(s) of 89515 bp (location: Chr7:43343490-43433004; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any 2310002F09Rik Mutation: 1 strain or line available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 2 reference(s)