Det1^em1Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Det1^em1Tcp
• Name: DET1 partner of COP1 E3 ubiquitin ligase; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:8332004
• Gene: Det1 Location: Chr7:78471295-78497011 bp, - strand Genetic Position: Chr7, 44.81 cM, cytoband D2
• Alliance: Det1^em1Tcp page

Mutation origin

• Strain of Origin: C57BL/6NCrl

Mutation description

• Allele Type: Endonuclease-mediated (Conditional ready, No functional change)
• Mutation: Insertion
• Mutation details:

  This allele was generated at The Centre for Phenogenomics by electroporating zygotes with Cas9 ribonucleoprotein complexes and guide RNAs with the spacer sequences GGCATCAAGGTTCTCAACGA and AGGCTCTTAGATACCACGCG and two single-strand oligonucleotides encoding loxP sites. This resulted in loxP sites flanking exon 3 (ENSMUSE00000201306) inserted after Chr7:78490105 and Chr7:78489317 (GRCm39). Cre-mediated deletion of the loxP-flanked region is predicted to generate a null allele. (J:322048)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Det1 Mutation: 19 strains or lines available

References

• Original: J:322048 The Centre for Phenogenomics, Direct Data Submission for The Centre for Phenogenomics Alleles. MGI Direct Data Submission. 2022
• All: 1 reference(s)