About   Help   FAQ
Oma1em1Wait
Endonuclease-mediated Allele Detail
Summary
Symbol: Oma1em1Wait
Name: OMA1 zinc metallopeptidase; endonuclease-mediated mutation 1, Timothy Wai
MGI ID: MGI:8316712
Synonyms: Oma1E324Q
Gene: Oma1  Location: Chr4:103171009-103229065 bp, + strand  Genetic Position: Chr4, 47.6 cM, cytoband C6
Alliance: Oma1em1Wait page
Mutation
origin
Strain of Origin:  C57BL6/N
Mutation
description
Allele Type:    Endonuclease-mediated (Not Applicable)
Mutation:    Single point mutation
 
Mutation details

Glutamic acid codon 324 (GAG) was changed to glutamate (CAG) (p.E324Q) using an sgRNA (equivalent to GTGCGATCTCATGGCCCAGGAGG) and an ssODN template with CRISPR/Cas9 technology. The mutation renders the encoded protein catalytically inactive. (J:379545)

Expression
In Mice Carrying this Mutation: 1 RNA-Seq or microarray experiment(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Oma1 Mutation:  26 strains or lines available
References
Original:  J:379545 Campos-Ribeiro MA, et al., Mutant CHCHD10 disrupts cytochrome c oxidation and activates mitochondrial retrograde signaling. EMBO Mol Med. 2026 Feb;18(2):542-574
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/14/2026
MGI 6.24
The Jackson Laboratory