Oma1^em1Wait
Endonuclease-mediated Allele Detail

Summary

• Symbol: Oma1^em1Wait
• Name: OMA1 zinc metallopeptidase; endonuclease-mediated mutation 1, Timothy Wai
• MGI ID: MGI:8316712
• Synonyms: Oma1^E324Q
• Gene: Oma1 Location: Chr4:103171009-103229065 bp, + strand Genetic Position: Chr4, 47.6 cM, cytoband C6
• Alliance: Oma1^em1Wait page

Mutation origin

• Strain of Origin: C57BL6/N

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Single point mutation
• Mutation details:

  Glutamic acid codon 324 (GAG) was changed to glutamate (CAG) (p.E324Q) using an sgRNA (equivalent to GTGCGATCTCATGGCCCAGGAGG) and an ssODN template with CRISPR/Cas9 technology. The mutation renders the encoded protein catalytically inactive. (J:379545)

Expression

In Mice Carrying this Mutation:

1 RNA-Seq or microarray experiment(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Oma1 Mutation: 26 strains or lines available

References

• Original: J:379545 Campos-Ribeiro MA, et al., Mutant CHCHD10 disrupts cytochrome c oxidation and activates mitochondrial retrograde signaling. EMBO Mol Med. 2026 Feb;18(2):542-574
• All: 1 reference(s)