Htttm5.1Ics
Targeted Allele Detail
|
|
| Symbol: |
Htttm5.1Ics |
| Name: |
huntingtin; targeted mutation 5.1, Mouse Clinical Institute |
| MGI ID: |
MGI:8297347 |
| Gene: |
Htt Location: Chr5:34919084-35069878 bp, + strand Genetic Position: Chr5, 17.92 cM
|
| Alliance: |
Htttm5.1Ics page
|
|
| Germline Transmission: |
Earliest citation of germline transmission:
J:82809
|
| Parent Cell Line: |
S3 (ES Cell)
|
| Strain of Origin: |
C57BL/6NCrl
|
|
| Allele Type: |
|
Targeted (Not Applicable) |
| Mutations: |
|
Insertion, Intragenic deletion
|
| |
|
Mutation details:
Aspartic aid codon 564 (GAT) in exon 13 (ENSMUSE00001232286) was replaced with glutamic acid, asparagine, leucine, tyrosine, phenylalanine, glutamine and serine codons (GAA AAC CTG TAC TTC CAG TCC) (c.1691_1692delATins AAAACCTGTACTTCCAGTCC, p.D564ENLYFQS). A loxP site flanked neomycin resistance gene and protamine-cre selection cassette was inserted into intron 12 and auto-excised, leaving a single loxP site.
(J:82809)
|
|
|
|
|
| Original: |
J:82809 European Mouse Mutant Archive, Information obtained from the European Mouse Mutant Archive (EMMA). Unpublished. 2003-2013; |
| All: |
1 reference(s) |
|