About   Help   FAQ
Htttm5.1Ics
Targeted Allele Detail
Summary
Symbol: Htttm5.1Ics
Name: huntingtin; targeted mutation 5.1, Mouse Clinical Institute
MGI ID: MGI:8297347
Gene: Htt  Location: Chr5:34919084-35069878 bp, + strand  Genetic Position: Chr5, 17.92 cM
Alliance: Htttm5.1Ics page
Mutation
origin
Germline Transmission:  Earliest citation of germline transmission: J:82809
Parent Cell Line:  S3 (ES Cell)
Strain of Origin:  C57BL/6NCrl
Mutation
description
Allele Type:    Targeted (Not Applicable)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsAspartic aid codon 564 (GAT) in exon 13 (ENSMUSE00001232286) was replaced with glutamic acid, asparagine, leucine, tyrosine, phenylalanine, glutamine and serine codons (GAA AAC CTG TAC TTC CAG TCC) (c.1691_1692delATins AAAACCTGTACTTCCAGTCC, p.D564ENLYFQS). A loxP site flanked neomycin resistance gene and protamine-cre selection cassette was inserted into intron 12 and auto-excised, leaving a single loxP site. (J:82809)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Htt Mutation:  180 strains or lines available
References
Original:  J:82809 European Mouse Mutant Archive, Information obtained from the European Mouse Mutant Archive (EMMA). Unpublished. 2003-2013;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
06/16/2026
MGI 6.24
The Jackson Laboratory