Htt^tm5.1Ics
Targeted Allele Detail

Summary

• Symbol: Htt^tm5.1Ics
• Name: huntingtin; targeted mutation 5.1, Mouse Clinical Institute
• MGI ID: MGI:8297347
• Gene: Htt Location: Chr5:34919084-35069878 bp, + strand Genetic Position: Chr5, 17.92 cM
• Alliance: Htt^tm5.1Ics page

Mutation origin

• Germline Transmission: Earliest citation of germline transmission: J:82809
• Parent Cell Line: S3 (ES Cell)
• Strain of Origin: C57BL/6NCrl

Mutation description

• Allele Type: Targeted (Not Applicable)
• Mutations: Insertion, Intragenic deletion
• Mutation details: Aspartic aid codon 564 (GAT) in exon 13 (ENSMUSE00001232286) was replaced with glutamic acid, asparagine, leucine, tyrosine, phenylalanine, glutamine and serine codons (GAA AAC CTG TAC TTC CAG TCC) (c.1691_1692delATins AAAACCTGTACTTCCAGTCC, p.D564ENLYFQS). A loxP site flanked neomycin resistance gene and protamine-cre selection cassette was inserted into intron 12 and auto-excised, leaving a single loxP site. (J:82809)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Htt Mutation: 180 strains or lines available

References

• Original: J:82809 European Mouse Mutant Archive, Information obtained from the European Mouse Mutant Archive (EMMA). Unpublished. 2003-2013
• All: 1 reference(s)