Shh^em1.1Ics
Endonuclease-mediated Allele Detail

Summary

• Symbol: Shh^em1.1Ics
• Name: sonic hedgehog; endonuclease-mediated mutation 1.1, Mouse Clinical Institute
• MGI ID: MGI:8297346
• Gene: Shh Location: Chr5:28661838-28672099 bp, - strand Genetic Position: Chr5, 14.39 cM
• Alliance: Shh^em1.1Ics page

Mutation origin

• Germline Transmission: Earliest citation of germline transmission: J:358405
• Parent Cell Line: S3 (ES Cell)
• Strain of Origin: C57BL/6NCrl

Mutation description

• Allele Type: Endonuclease-mediated (Not Specified)
• Mutation: Single point mutation
• Mutation details:

  The third base of serine codon 293 (AGC) in exon 3 (ENSMUSE00000409051) was changed to a T (c.879C>T p.S293S) using an sgRNA (equivalent to GACTTTAGCTATTGGAGCGC) and an ssODN template with CRISPR/Cas9 technology. A loxP site flanked neomycin resistance gene and protamine-cre selection cassette was inserted into intron 2 and auto-excised, leaving a single loxP site. (J:358405)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Shh Mutation: 49 strains or lines available

References

• Original: J:358405 MGI and ICS/MCI, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC) Generated by ICS/MCI. Database Release. 2024
• All: 1 reference(s)