Shhem1.1Ics
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Shhem1.1Ics |
| Name: |
sonic hedgehog signaling molecule; endonuclease-mediated mutation 1.1, Mouse Clinical Institute |
| MGI ID: |
MGI:8297346 |
| Gene: |
Shh Location: Chr5:28661838-28672099 bp, - strand Genetic Position: Chr5, 14.39 cM
|
| Alliance: |
Shhem1.1Ics page
|
|
| Germline Transmission: |
Earliest citation of germline transmission:
J:358405
|
| Parent Cell Line: |
S3 (ES Cell)
|
| Strain of Origin: |
C57BL/6NCrl
|
|
| Allele Type: |
|
Endonuclease-mediated (Not Specified) |
| Mutation: |
|
Single point mutation
|
| |
|
Mutation details:
The third base of serine codon 293 (AGC) in exon 3 (ENSMUSE00000409051) was changed to a T (c.879C>T p.S293S) using an sgRNA (equivalent to GACTTTAGCTATTGGAGCGC) and an ssODN template with CRISPR/Cas9 technology. A loxP site flanked neomycin resistance gene and protamine-cre selection cassette was inserted into intron 2 and auto-excised, leaving a single loxP site.
(J:358405)
|
|
|
|
|
| Original: |
J:358405 MGI and ICS/MCI, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC) Generated by ICS/MCI. Database Release. 2024; |
| All: |
1 reference(s) |
|