Rbbp8^em2Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rbbp8^em2Tcp
• Name: retinoblastoma binding protein 8, endonuclease; endonuclease-mediated mutation 2, The Centre for Phenogenomics
• MGI ID: MGI:8293353
• Gene: Rbbp8 Location: Chr18:11766333-11876264 bp, + strand Genetic Position: Chr18, 5.85 cM
• Alliance: Rbbp8^em2Tcp page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details:

  This allele was generated at The Centre for Phenogenomics by injecting Cas9 endonuclease and a guide RNA with the spacer sequence TTTGGCAGATAGCTTCTCCC and a single-strand oligonucleotide encoding the changes in Rbbp8. The derived allele was repaired by non-homologous end-joining introducing a 14-bp deletion Chr18:11865329 to 11865342 predicted to introduce a frameshift and premature termination codon. The repair template was not incorporated. (J:200814)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rbbp8 Mutation: 51 strains or lines available

References

• Original: J:200814 Toronto Centre for Phenogenomics, Strains and alleles submitted by Toronto Centre for Phenogenomics (NorCOMM2, funded by Genome Canada and Ontario Genomics Institute OGI-051). MGI Direct Data Submission. 2013
• All: 1 reference(s)