Trp53^em1Klgw
Endonuclease-mediated Allele Detail

Summary

• Symbol: Trp53^em1Klgw
• Name: transformation related protein 53; endonuclease-mediated mutation 1, Klas G Wiman
• MGI ID: MGI:8288387
• Synonyms: Trp53^R210X
• Gene: Trp53 Location: Chr11:69471185-69482699 bp, + strand Genetic Position: Chr11, 42.83 cM, cytoband B2-C
• Alliance: Trp53^em1Klgw page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Nucleotide substitutions
• Mutation details: Arginine codon 210 (CGC) in exon 6 was changed to a stop codon (TGA) (p.R210*) using an sgRNA (equivalent to GCAGACTTTTCGCCACAGCGTGG) and an ssODN template with CRISPR/Cas9 technology. (J:378414)

Tumor Data

List all tumor models in MMHCdb carrying Trp53^em1Klgw

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Trp53 Mutation: 246 strains or lines available

References

• Original: J:378414 Strandgren C, et al., Mice carrying nonsense mutant p53 develop frequent multicentric or metastatic tumors. Cell Death Dis. 2025 Dec 11;17(1):85
• All: 1 reference(s)