About   Help   FAQ
Trp53em1Klgw
Endonuclease-mediated Allele Detail
Summary
Symbol: Trp53em1Klgw
Name: transformation related protein 53; endonuclease-mediated mutation 1, Klas G Wiman
MGI ID: MGI:8288387
Synonyms: Trp53R210X
Gene: Trp53  Location: Chr11:69471185-69482699 bp, + strand  Genetic Position: Chr11, 42.83 cM, cytoband B2-C
Alliance: Trp53em1Klgw page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Nucleotide substitutions
 
Mutation detailsArginine codon 210 (CGC) in exon 6 was changed to a stop codon (TGA) (p.R210*) using an sgRNA (equivalent to GCAGACTTTTCGCCACAGCGTGG) and an ssODN template with CRISPR/Cas9 technology. (J:378414)
Tumor Data
List all tumor models in MMHCdb carrying Trp53em1Klgw
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Trp53 Mutation:  249 strains or lines available
References
Original:  J:378414 Strandgren C, et al., Mice carrying nonsense mutant p53 develop frequent multicentric or metastatic tumors. Cell Death Dis. 2025 Dec 11;17(1):85
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/26/2026
MGI 6.24
The Jackson Laboratory