Gt(ROSA)26Sor^{em3(CAG-TFRC/OVAL)Dest}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gt(ROSA)26Sor^{em3(CAG-TFRC/OVAL)Dest}
• Name: gene trap ROSA 26, Philippe Soriano; endonuclease-mediated mutation 3, Daria Esterhazy
• MGI ID: MGI:8283244
• Synonyms: Rosa26-tmO
• Gene: Gt(ROSA)26Sor Location: Chr6:113044389-113054205 bp, - strand Genetic Position: Chr6, 52.73 cM
• Alliance: Gt(ROSA)26Sor^{em3(CAG-TFRC/OVAL)Dest} page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Conditional ready, Epitope tag, Inserted expressed sequence)
• Mutation: Insertion
• Gt(ROSA)26Sor^{em3(CAG-TFRC/OVAL)Dest} expresses 2 genes
  Knock-in expresses:
  

  Organism

  Expressed Gene

  Homolog in Mouse

  Note

  chicken

  OVAL (396058)

  human

  TFRC (7037)

  Tfrc	(MGI:98822)

• Mutation details:

  The allele was generated by CRISPR/Cas9 endonuclease-mediated genome editing using crRNAs (ACTCCAGTCTTTCTAGAAGA) and tracrRNAs to insert a CMV-IE enhancer/chicken beta-actin/rabbit beta-globin hybrid promoter (CAG), a loxP-flanked Neo/STOP cassette, residues 1-118 of the human transferrin receptor (TFRC) fused to residues 139-386 of the chicken ovalbumin gene (OVAL), a 3XFLAG tag, and a bovine growth hormone polyadenylation signal (bGHpolyA) into the Gt(ROSA)26Sor locus on Chromosome 6. (J:101977, J:391596)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Gt(ROSA)26Sor Mutation: 1243 strains or lines available

References

• Original: J:385369 Zhou YD, et al., Tissue-specific tolerance mechanisms and lymph node co-drainage shape T cell immunity in the upper digestive system and pancreatic cancer progression. Cell Rep. 2026 May 5;45(5):117324
• All: 3 reference(s)