Orc1^em1Ics
Endonuclease-mediated Allele Detail

Summary

• Symbol: Orc1^em1Ics
• Name: origin recognition complex, subunit 1; endonuclease-mediated mutation 1, Mouse Clinical Institute
• MGI ID: MGI:8280976
• Gene: Orc1 Location: Chr4:108436651-108472030 bp, + strand Genetic Position: Chr4, 50.64 cM, cytoband D
• Alliance: Orc1^em1Ics page

Mutation origin

• Germline Transmission: Earliest citation of germline transmission: J:82809
• Parent Cell Line: S3 (ES Cell)
• Strain of Origin: C57BL/6NCrl

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Nucleotide substitutions
• Mutation details: Arginine codon 104 (CGC) in exon 4 (ENSMUSE00001307667) was changed to glutamine (CAG) (c.311_312delGCinsAG p.R104Q) using CRISPR/Cas9 technology with an sgRNA (equivalent to AGGCCGCAGTCCTCCTGCAC) and an ssODN template (CAATGATGGTCTCCACATTAATCTTGTTATCCCAGTCAGAACAGTCATACCAGAATATCTCCTGTGCCGGCGGACTCTGGCCTAACAAGTGCCTTTTAGAGACAGGAATCTCAAGGAATCTGACAAACC). (J:82809)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Orc1 Mutation: 62 strains or lines available

References

• Original: J:82809 European Mouse Mutant Archive, Information obtained from the European Mouse Mutant Archive (EMMA). Unpublished. 2003-2013
• All: 1 reference(s)