Scn9a^em1Dhh
Endonuclease-mediated Allele Detail

Summary

• Symbol: Scn9a^em1Dhh
• Name: sodium channel, voltage-gated, type IX, alpha; endonuclease-mediated mutation 1, David H Hackos
• MGI ID: MGI:8272191
• Synonyms: Scn9a YWV2SRL
• Gene: Scn9a Location: Chr2:66310424-66465306 bp, - strand Genetic Position: Chr2, 39.13 cM
• Alliance: Scn9a^em1Dhh page

Mutation origin

• Strain of Origin: C57BL/6N

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Nucleotide substitutions
• Mutation details:

  Tyrosine codon 1546 (TAC) was changed to serine (TCA) (p.Y1546S), tryptophan codon 1547 (TGG) to arginine (CGG) (p.W1547R) and valine codon 1550 (GTG) to leucine (CTG) (p.V1550L) using an sgRNA (targeting TGTGCTATACTGGATCAACG) and an ssODN template with CRISPR/Cas9 technology. The mutations, in the aryl-sulfonamide-binding site of the encoded protein, reduce SCN9A binding to its agonist GNE-3565 by more than 100-fold. (J:361897)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Scn9a Mutation: 125 strains or lines available

References

• Original: J:361897 Deng L, et al., Nav1.7 is essential for nociceptor action potentials in the mouse in a manner independent of endogenous opioids. Neuron. 2023 Sep 6;111(17):2642-2659.e13
• All: 1 reference(s)