Gt(ROSA)26Sor^em22Arz
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gt(ROSA)26Sor^em22Arz
• Name: gene trap ROSA 26, Philippe Soriano; endonuclease-mediated mutation 22, Aamir Zuberi
• MGI ID: MGI:8262940
• Gene: Gt(ROSA)26Sor Location: Chr6:113044389-113054205 bp, - strand Genetic Position: Chr6, 52.73 cM
• Alliance: Gt(ROSA)26Sor^em22Arz page

Mutation origin

• Strain of Origin: C57BL/6NJ

Mutation description

• Allele Type: Endonuclease-mediated (RMCE-ready)
• Mutation: Insertion
• Mutation details:

  Using CRISPR/Cas9 endonuclease-mediated genome editing/oligo-mediated homology directed repair. First, sgRNAs (ACTCCAGTCTTTCTAGAAGA and CTCCAGTCTTTCTAGAAGAT) were selected to target intron 1 of the Gt(ROSA)26Sor locus on Chromosome 6 and a long single stranded (lss) DNA donor was used to integrate the Bxb1 attB-GT site into the resulting dsDNA break. (J:101977)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Gt(ROSA)26Sor Mutation: 1243 strains or lines available

References

• Original: J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017
• All: 1 reference(s)