Rad54l2^em1Lmjn
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rad54l2^em1Lmjn
• Name: RAD54 like 2 (S. cerevisiae); endonuclease-mediated mutation 1, Lauryl Nutter
• MGI ID: MGI:8255335
• Gene: Rad54l2 Location: Chr9:106565281-106666393 bp, - strand Genetic Position: Chr9, 57.98 cM, cytoband F1
• Alliance: Rad54l2^em1Lmjn page

Mutation origin

• Strain of Origin: C57BL/6NCrl

Mutation description

• Allele Type: Endonuclease-mediated (Conditional ready, No functional change)
• Mutation: Insertion
• Mutation details:

  This allele was generated at The Centre for Phenogenomics by transducing zygotes with adeno-associated virus with a repair template with loxP sites flanking exon 9 followed by electroporating transduced zygotes with Cas9 ribonucleoprotein complexes with guide RNAs with the spacer sequences CTTGGTTAGCTAATCTACCT and GTTAACGTAAACCAGCTATC. This resulted in loxP sites inserted after Chr9:106593131 and Chr9:106593652 flanking exon ENSMUSE00000259806 (GRCm39). Cre-mediated deletion of the loxP-flanked region is predicted to generate a null allele. (J:322048)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rad54l2 Mutation: 177 strains or lines available

References

• Original: J:322048 The Centre for Phenogenomics, Direct Data Submission for The Centre for Phenogenomics Alleles. MGI Direct Data Submission. 2022
• All: 1 reference(s)