Gt(ROSA)26Sor^{em1(CAG-KCNJ2)Tchn}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gt(ROSA)26Sor^{em1(CAG-KCNJ2)Tchn}
• Name: gene trap ROSA 26, Philippe Soriano; endonuclease-mediated mutation 1, Ting Chen
• MGI ID: MGI:8250827
• Synonyms: R26-hKCNJ2
• Gene: Gt(ROSA)26Sor Location: Chr6:113044389-113054205 bp, - strand Genetic Position: Chr6, 52.73 cM
• Alliance: Gt(ROSA)26Sor^{em1(CAG-KCNJ2)Tchn} page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Conditional ready, Inserted expressed sequence)
• Mutation: Insertion
• Gt(ROSA)26Sor^{em1(CAG-KCNJ2)Tchn} expresses 1 gene
  Knock-in expresses:
  

  Organism

  Expressed Gene

  Homolog in Mouse

  Note

  human

  KCNJ2 (3759)

  Kcnj2

  (MGI:104744)

• Mutation details:

  An sgRNA (ggcattctacacgttattgc) was designed to target the Gt(ROSA)26Sor gene for insertion of a CAG promoter upstream of a loxP-flanked neomycin resistance (neo) cassette and a human potassium inwardly-rectifying channel, subfamily J, member 2 (KCNJ2) coding sequence. (J:101977, J:372885)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Gt(ROSA)26Sor Mutation: 1243 strains or lines available

References

• Original: J:372885 Chen D, et al., Fibroblast bioelectric signaling drives hair growth. Cell. 2025 Sep 18;188(19):5175-5193.e21
• All: 2 reference(s)