Gt(ROSA)26Sor^{em2(CAG-Htr4*/GFP,-jRGECO1a)Yuli}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gt(ROSA)26Sor^{em2(CAG-Htr4*/GFP,-jRGECO1a)Yuli}
• Name: gene trap ROSA 26, Philippe Soriano; endonuclease-mediated mutation 2, Yulong Li
• MGI ID: MGI:8246660
• Gene: Gt(ROSA)26Sor Location: Chr6:113044389-113054205 bp, - strand Genetic Position: Chr6, 52.73 cM
• Alliance: Gt(ROSA)26Sor^{em2(CAG-Htr4*/GFP,-jRGECO1a)Yuli} page

Mutation origin

• Strain of Origin: C57BL/6NCrl

Mutation description

• Allele Type: Endonuclease-mediated (Conditional ready, Reporter)
• Mutation: Insertion
• Mutation details:

  Using CRISPR/Cas9 methodologies (sgRNA: AAGGCCGCACCCTTCTCCGG AGG), the targeting construct composed of (from 5' to 3') CAG-loxP-STOP-loxP-gGRAB)5-HT3.0(-iP2A- jRGECO1a-WPRE-bGH pA was inserted into Gt(ROSA)26Sor locus. The STOP codon is composed of 5xSTOP sequences. jRGECO1a encodes a red fluorescent calcium sensor. gGRAB)5-HT3.0( encodes a modified metabotropic 5-HT receptor fused to circularly permuted green fluorescent protein (cpEGFP). (J:101977, J:363780)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Gt(ROSA)26Sor Mutation: 1243 strains or lines available

References

• Original: J:363780 Touhara KK, et al., Topological segregation of stress sensors along the gut crypt-villus axis. Nature. 2025 Feb 12
• All: 2 reference(s)