Gt(ROSA)26Sor^{em1(CAG-jRGECO1a,-ADRA2A*/GFP)Yuli}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gt(ROSA)26Sor^{em1(CAG-jRGECO1a,-ADRA2A*/GFP)Yuli}
• Name: gene trap ROSA 26, Philippe Soriano; endonuclease-mediated mutation 1, Yulong Li
• MGI ID: MGI:8246652
• Synonyms: dual-NECa
• Gene: Gt(ROSA)26Sor Location: Chr6:113044389-113054205 bp, - strand Genetic Position: Chr6, 52.73 cM
• Alliance: Gt(ROSA)26Sor^{em1(CAG-jRGECO1a,-ADRA2A*/GFP)Yuli} page

Mutation origin

• Strain of Origin: C57BL/6NCrl

Mutation description

• Allele Type: Endonuclease-mediated (Conditional ready, Reporter)
• Mutation: Insertion
• Mutation details:

  Using CRISPR/cas9 methodologies (sgRNA: AAGGCCGCACCCTTCTCCGGAGG), the targeting construct composed of (from 5' to 3') CAG-loxP-STOP-loxP-jRGECO1a-iP2A-GRAB)NE2m(-WPRE-bGH pA was inserted into Gt(ROSA)26Sor locus. The STOP codon is composed of a pBS302 STOP cassette. jRGECO1a encodes a red fluorescent calcium sensor. GRAB)NE2m (encodes a second-generation GPCR-activation-based green fluorescent norepinephrine sensor (variant of Adra2a). (J:101977, J:349896)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Gt(ROSA)26Sor Mutation: 1243 strains or lines available

References

• Original: J:349896 Feng J, et al., Monitoring norepinephrine release in vivo using next-generation GRAB(NE) sensors. Neuron. 2024 Jun 19;112(12):1930-1942.e6
• All: 2 reference(s)