Gt(ROSA)26Sor^{em1(CAG-Tfeb*)Lusu}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gt(ROSA)26Sor^{em1(CAG-Tfeb*)Lusu}
• Name: gene trap ROSA 26, Philippe Soriano; endonuclease-mediated mutation 1, Lu Sun
• MGI ID: MGI:8242767
• Gene: Gt(ROSA)26Sor Location: Chr6:113044389-113054205 bp, - strand Genetic Position: Chr6, 52.73 cM
• Alliance: Gt(ROSA)26Sor^{em1(CAG-Tfeb*)Lusu} page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Conditional ready)
• Mutation: Insertion
• Mutation details:

  Using CRISPR/Cas9 endonuclease-mediated genome editing, a guide RNA [ACUCCAGUCUUUCUAGAAGA] was selected to introduce a CMV-IE enhancer/chicken beta-actin/rabbit beta-globin hybrid promoter (CAG), followed by a loxP-flanked STOP cassette, a Halo-tagged transcription factor EB sequence, harboring the S141A and S210A mutations, into the Gt(ROSA)26Sor locus. (J:101977, J:371751)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Gt(ROSA)26Sor Mutation: 1243 strains or lines available

References

• Original: J:371751 Zhang Y, et al., Neurons sequester the cholesterol-inhibiting TFEB in oligodendrocyte cytoplasm to safeguard myelination and neural function. Cell Rep. 2025 Sep 5;44(9):116252
• All: 2 reference(s)