Grifinem1(IMPC)Tcp
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Grifinem1(IMPC)Tcp |
| Name: |
galectin-related inter-fiber protein; endonuclease-mediated mutation 1, Toronto Centre for Phenogenomics |
| MGI ID: |
MGI:8242696 |
| Gene: |
Grifin Location: Chr5:140548874-140550826 bp, - strand Genetic Position: Chr5, 79.1 cM, cytoband G1
|
| Alliance: |
Grifinem1(IMPC)Tcp page
|
| IMPC: |
Grifin gene page |
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details:
This allele was generated at The Centre for Phenogenomics using Cas9 and guides with spacer sequences ACTACACACGTTATAGATGC and GCTGAGGGCAATGACACTGC that targeted exon(s) ENSMUSE00000298247.4 ENSMUSE00000298256.2 ENSMUSE00000298264.6 ENSMUSE00002185318.1 ENSMUSE00002185319.1. This resulted in deletion(s) of 1873 bp (location: Chr5:140548940-140550812; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
|
|
| Original: |
J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023; |
| All: |
2 reference(s) |
|