Catsperdem1(IMPC)Hmgu
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Catsperdem1(IMPC)Hmgu |
| Name: |
cation channel sperm associated auxiliary subunit delta; endonuclease-mediated mutation 1, Helmholtz Zentrum Muenchen GmbH |
| MGI ID: |
MGI:8242693 |
| Gene: |
Catsperd Location: Chr17:56935143-56971456 bp, + strand Genetic Position: Chr17, 29.43 cM
|
| Alliance: |
Catsperdem1(IMPC)Hmgu page
|
| IMPC: |
Catsperd gene page |
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details:
This allele was generated at Helmholtz-Zentrum Muenchen using Cas9 and guides with spacer sequences CGCTCCAGCAGATCAGGGTG, GCGCTCCAGCAGATCAGGGT, GGCTCTCGCTGGCCTACAAT, and TGGAGATTCAGAACGGCCTA. This resulted in deletion(s) of 4038 bp (location: Chr17:56939024-56943061; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Catsperd Mutation: |
49 strains or lines available
|
|
| Original: |
J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023; |
| All: |
2 reference(s) |
|